Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing paaZ gene

Properties
Regulog: PaaR - Mycobacteriaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Mycobacterium abscessus ATCC 19977
Position: -108
Score: 4.8959
Sequence: ACTGACCGTTCGGTCGGCCACA
Position: -35
Score: 5.42127
Sequence: ACCGAACGAATGGACGGTTGGT
Locus tag: MAB_0900c
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Locus tag: MAB_0899c
Name: ethD
Funciton: Possible ethyl tert-butyl ether degradation protein EthD
paaZ-ethD -108 4.9 ACTGACCGTTCGGTCGGCCACA MAB_0900c
-35 5.4 ACCGAACGAATGGACGGTTGGT