Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing paaK gene

Properties
Regulog: PaaR - Mycobacteriaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Mycobacterium abscessus ATCC 19977
Position: -37
Score: 6.13347
Sequence: AATAACCGAACATTCGGTCGGT
Position: -33
Score: 4.50201
Sequence: ACCGAACATTCGGTCGGTAATC
Locus tag: MAB_0906
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: MAB_0907
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: MAB_0908
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: MAB_0909
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: MAB_0910
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: MAB_0911
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaA-paaB-paaC-paaD-paaE-paaK -37 6.1 AATAACCGAACATTCGGTCGGT MAB_0906
-33 4.5 ACCGAACATTCGGTCGGTAATC