Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing paaR gene

Properties
Regulog: PaaR - Mycobacteriaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Mycobacterium abscessus ATCC 19977
Position: -92
Score: 6.15351
Sequence: AATAACCGATCGTTCGGTCGGT
Position: -88
Score: 4.67361
Sequence: ACCGATCGTTCGGTCGGTTGTC
Locus tag: MAB_0901c
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaR -92 6.2 AATAACCGATCGTTCGGTCGGT MAB_0901c
-88 4.7 ACCGATCGTTCGGTCGGTTGTC