Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing paaF gene

Properties
Regulog: PaaR - Mycobacteriaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Mycobacterium abscessus ATCC 19977
Position: -48
Score: 4.67361
Sequence: GACAACCGACCGAACGATCGGT
Position: -44
Score: 6.15351
Sequence: ACCGACCGAACGATCGGTTATT
Locus tag: MAB_0902
Name: paaJ
Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
Locus tag: MAB_0903
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: MAB_0904
Name: paaH
Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Locus tag: MAB_0905
Name: paaG
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
paaJ-paaF-paaH-paaG -48 4.7 GACAACCGACCGAACGATCGGT MAB_0902
-44 6.2 ACCGACCGAACGATCGGTTATT