Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing grtP gene

Regulog: SdaR - Xanthomonadales
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Proteobacteria/Gamma
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Xanthomonas axonopodis pv. citri str. 306
Position: -102
Score: 6.08382
Locus tag: XAC4361
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: XAC4360
Name: garK
Funciton: Glycerate kinase (EC
Locus tag: XAC4359
Name: sdaR
Funciton: Glycerate utilization transcriptional regulator SdaR, SdaR family
grtP-garK-sdaR -102 6.1 ATTTGGGCAGTTGCACAAAA XAC4361
Xanthomonas campestris pv. campestris str. ATCC 33913
Position: -88
Score: 5.12387
Locus tag: XCC4227
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: XCC4226
Name: garK
Funciton: Glycerate kinase (EC
Locus tag: XCC4225
Name: sdaR
Funciton: Glycerate utilization transcriptional regulator SdaR, SdaR family