Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ctaD gene

Regulog: FixK - Caulobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -45
Score: 5.62979
Position: -12
Score: 4.89948
Locus tag: CC3407
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC
Locus tag: CC3406
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC
Locus tag: CC3405
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: CC3404
Name: ctaX
Funciton: Hypothetical protein in cta-cyo gene cluster
Locus tag: CC3403
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: CC3402
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC
ctaC-ctaD-ctaB-ctaX-ctaG-ctaE -45 5.6 GCCTTGATCGGGCTCAAATC CC3407
Caulobacter segnis ATCC 21756
Position: -45
Score: 4.1852
Position: -12
Score: 4.89948
Locus tag: Cseg_0283
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC
Locus tag: Cseg_0284
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC
Locus tag: Cseg_0285
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: Cseg_0286
Name: ctaX
Funciton: Hypothetical protein in cta-cyo gene cluster
Locus tag: Cseg_0287
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: Cseg_0288
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC
ctaC-ctaD-ctaB-ctaX-ctaG-ctaE -45 4.2 ACATTGATCATCGTCAAATC Cseg_0283
Caulobacter sp. K31
Position: -75
Score: 4.3412
Position: -42
Score: 4.89948
Locus tag: Caul_4506
Name: ctaC
Funciton: Cytochrome c oxidase polypeptide II (EC
Locus tag: Caul_4505
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC
Locus tag: Caul_4504
Name: ctaB
Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: Caul_4503
Name: ctaX
Funciton: Hypothetical protein in cta-cyo gene cluster
Locus tag: Caul_4502
Name: ctaG
Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: Caul_4501
Name: ctaE
Funciton: Cytochrome c oxidase polypeptide III (EC
ctaC-ctaD-ctaB-ctaX-ctaG-ctaE -75 4.3 ACGTTGATGTACGTCAAATC Caul_4506