Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing cydB gene

Regulog: FixK - Caulobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -93
Score: 6.17819
Locus tag: CC0762
Name: cydA
Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Locus tag: CC0763
Name: cydB
Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Caulobacter segnis ATCC 21756
Position: -92
Score: 5.75795
Locus tag: Cseg_3605
Name: cydA
Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Locus tag: Cseg_3604
Name: cydB
Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Locus tag: Cseg_3603
Name: cydX
Funciton: CydX protein, presumably involved in maturation of CydAB complex
cydA-cydB-cydX -92 5.8 TCCTTGATCACGATCAAGGC Cseg_3605
Caulobacter sp. K31
Position: -92
Score: 5.4648
Locus tag: Caul_0634
Name: cydA
Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Locus tag: Caul_0635
Name: cydB
Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Locus tag: Caul_0636
Name: cydX
Funciton: CydX protein, presumably involved in maturation of CydAB complex
cydA-cydB-cydX -92 5.5 TCCTTGACACCAATCAAAGC Caul_0634