Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing cydD gene

Regulog: FixK - Caulobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -50
Score: 6.17819
Locus tag: CC0761
Name: cydD
Funciton: ATP-binding/permease protein CydD
Locus tag: CC0760
Name: cydC
Funciton: ATP-binding/permease protein CydC
Caulobacter segnis ATCC 21756
Position: -50
Score: 5.75795
Locus tag: Cseg_3606
Name: cydD
Funciton: ATP-binding/permease protein CydD
Locus tag: Cseg_3607
Name: cydC
Funciton: ATP-binding/permease protein CydC
cydD-cydC -50 5.8 GCCTTGATCGTGATCAAGGA Cseg_3606
Caulobacter sp. K31
Position: -77
Score: 4.06203
Position: -51
Score: 5.4648
Locus tag: Caul_0633
Name: cydD
Funciton: ATP-binding/permease protein CydD
Locus tag: Caul_0632
Name: cydC
Funciton: ATP-binding/permease protein CydC
Locus tag: Caul_0631
Name: fixL
Funciton: Two-component oxygen-sensor histidine kinase FixL
Locus tag: Caul_0630
Name: fixJ
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
Locus tag: Caul_0629
Name: fixK
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
cydD-cydC-fixL-fixJ-fixK -77 4.1 CCCTATAGACGCGTCAAGGC Caul_0633