Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing fixK gene

Properties
Regulog: FixK - Caulobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -143
Score: 5.1979
Sequence: GCCTTGATCGGCGTCAAAAT
Locus tag: CC0752
Name: fixK
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
fixK -143 5.2 GCCTTGATCGGCGTCAAAAT CC0752
Caulobacter segnis ATCC 21756
Position: -139
Score: 5.23266
Sequence: ACTTTGATCCCGGTCAAAAC
Locus tag: Cseg_3612
Name: fixK
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
fixK -139 5.2 ACTTTGATCCCGGTCAAAAC Cseg_3612
Caulobacter sp. K31
Position: -77
Score: 4.06203
Sequence: CCCTATAGACGCGTCAAGGC
Position: -51
Score: 5.4648
Sequence: GCTTTGATTGGTGTCAAGGA
Locus tag: Caul_0633
Name: cydD
Funciton: ATP-binding/permease protein CydD
Locus tag: Caul_0632
Name: cydC
Funciton: ATP-binding/permease protein CydC
Locus tag: Caul_0631
Name: fixL
Funciton: Two-component oxygen-sensor histidine kinase FixL
Locus tag: Caul_0630
Name: fixJ
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
Locus tag: Caul_0629
Name: fixK
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
cydD-cydC-fixL-fixJ-fixK -77 4.1 CCCTATAGACGCGTCAAGGC Caul_0633
-51 5.5 GCTTTGATTGGTGTCAAGGA