Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ccoG gene

Regulog: FixK - Caulobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter segnis ATCC 21756
Position: -75
Score: 5.71291
Locus tag: Cseg_1883
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: Cseg_1884
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: Cseg_1885
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: Cseg_1886
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
Locus tag: Cseg_1887
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Cseg_1888
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Cseg_1889
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: Cseg_1890
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS -75 5.7 GCTTTGAGACAGATCAAAGC Cseg_1883
Caulobacter sp. K31
Position: -69
Score: 4.53934
Locus tag: Caul_2437
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: Caul_2438
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: Caul_2439
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: Caul_2440
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
Locus tag: Caul_2441
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Caul_2442
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Caul_2443
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: Caul_2444
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS -69 4.5 GCTTTGACCCAAGTCAATTT Caul_2437
Phenylobacterium zucineum HLK1
Position: -40
Score: 5.9562
Locus tag: PHZ_c2814
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: PHZ_c2813
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: PHZ_c2812
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: PHZ_c2811
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
Locus tag: PHZ_c2810
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: PHZ_c2809
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: PHZ_c2808
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: PHZ_c2807
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS -40 6 GCCTTGACCGATATCAAGGC PHZ_c2814