Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing hemN gene

Properties
Regulog: FixK - Caulobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter segnis ATCC 21756
Position: -65
Score: 4.70535
Sequence: GGATTGATCCAAATCACGGC
Locus tag: Cseg_1891
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN -65 4.7 GGATTGATCCAAATCACGGC Cseg_1891
Caulobacter sp. K31
Position: -64
Score: 5.20395
Sequence: GACTTGACGCGCGTCAAGGT
Locus tag: Caul_3872
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN -64 5.2 GACTTGACGCGCGTCAAGGT Caul_3872
Phenylobacterium zucineum HLK1
Position: -52
Score: 5.26772
Sequence: TCCTTGATCTGAATCAGGGC
Locus tag: PHZ_c2806
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN -52 5.3 TCCTTGATCTGAATCAGGGC PHZ_c2806