Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ccoG gene

Regulog: FnrN - Rhodobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 85 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -84
Score: 5.43887
Locus tag: Jann_3853
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Jann_3852
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Jann_3851
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: Jann_3850
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -84 5.4 AACTTGATCCACGTCAAAGC Jann_3853
Loktanella vestfoldensis SKA53
Position: -177
Score: 5.56421
Locus tag: SKA53_08641
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: SKA53_08646
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: SKA53_08651
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: SKA53_08656
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -177 5.6 TGCTTGATCCACATCAAGGA SKA53_08641
Oceanicola batsensis HTCC2597
Position: -77
Score: 5.70955
Locus tag: OB2597_20591
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: OB2597_20596
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: OB2597_20601
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: OB2597_20606
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -77 5.7 GCCTTGATGCAGATCAAAGG OB2597_20591
Paracoccus denitrificans PD1222
Position: -70
Score: 5.26945
Locus tag: Pden_1844
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Pden_1843
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Pden_1842
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: Pden_1841
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -70 5.3 CGCTTGACGCAGATCAATGC Pden_1844
Rhodobacter sphaeroides 2.4.1
Position: -136
Score: 5.11642
Position: -104
Score: 5.38772
Locus tag: RSP_0696
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: RSP_0695
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: RSP_0694
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: RSP_0693
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
Locus tag: RSP_0692
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: RSP_0691
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: RSP_0690
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: RSP_0689
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS -136 5.1 TCCTTGATGAGGATCAAGTA RSP_0696
Rhodobacterales bacterium HTCC2654
Position: 0
Score: 5.17218
Locus tag: RB2654_10004
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: RB2654_09999
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: RB2654_09994
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: RB2654_09989
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS 0 5.2 ATGTTGATCCAAGTCAAGGC RB2654_10004
Roseobacter sp. MED193
Position: -180
Score: 5.42996
Locus tag: MED193_11193
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: MED193_11188
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: MED193_11183
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: MED193_11178
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -180 5.4 TTTTTGATCCACGTCAAAGA MED193_11193
Roseovarius sp. 217
Position: -73
Score: 5.45265
Locus tag: ROS217_12261
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: ROS217_12266
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: ROS217_12271
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: ROS217_12276
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -73 5.5 AATTTGATGCAGGTCAAAGC ROS217_12261
Silicibacter TM1040
Position: -79
Score: 5.42274
Locus tag: TM1040_2540
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: TM1040_2539
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: TM1040_2538
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: TM1040_2537
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -79 5.4 TTTTTGATCCACGTCAAAGT TM1040_2540
Silicibacter pomeroyi DSS-3
Position: -80
Score: 5.4002
Locus tag: SPO3522
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: SPO3521
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: SPO3520
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: SPO3519
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -80 5.4 TTTTTGACCCATATCAAAGT SPO3522
Sulfitobacter sp. EE-36
Position: -74
Score: 5.63715
Locus tag: EE36_02218
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: EE36_02213
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: EE36_02208
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: EE36_02203
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -74 5.6 TGTTTGATGCAGATCAAAGC EE36_02218