Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ccoQ gene

Regulog: FnrN - Rhodobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 85 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -126
Score: 5.62364
Locus tag: Jann_3857
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: Jann_3856
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: Jann_3855
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: Jann_3854
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
ccoN-ccoO-ccoQ-ccoP -126 5.6 GGCTTGACCCAGATCAAGGT Jann_3857
Loktanella vestfoldensis SKA53
Position: -105
Score: 5.2607
Position: -83
Score: 5.13034
Locus tag: SKA53_08741
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: SKA53_08736
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: SKA53_08731
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: SKA53_08726
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
ccoN-ccoO-ccoQ-ccoP -105 5.3 GCATTGATCCATGTCAAACG SKA53_08741
Oceanicola batsensis HTCC2597
Position: -73
Score: 4.93161
Locus tag: OB2597_20571
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: OB2597_20576
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: OB2597_20581
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: OB2597_20586
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
ccoN-ccoO-ccoQ-ccoP -73 4.9 CAATTGACCCAAGTCAAAAC OB2597_20571
Paracoccus denitrificans PD1222
Position: -124
Score: 5.27804
Locus tag: Pden_1848
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: Pden_1847
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: Pden_1846
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: Pden_1845
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
ccoN-ccoO-ccoQ-ccoP -124 5.3 AGATTGACGCAGATCAAAGT Pden_1848
Rhodobacter sphaeroides 2.4.1
Position: -136
Score: 5.11642
Position: -104
Score: 5.38772
Locus tag: RSP_0696
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: RSP_0695
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: RSP_0694
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: RSP_0693
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
Locus tag: RSP_0692
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: RSP_0691
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: RSP_0690
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC
Locus tag: RSP_0689
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS -136 5.1 TCCTTGATGAGGATCAAGTA RSP_0696
Rhodobacterales bacterium HTCC2654
Position: -168
Score: 5.28189
Position: -125
Score: 5.43178
Locus tag: RB2654_10029
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: RB2654_10024
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: RB2654_10019
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: RB2654_10014
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
ccoN-ccoO-ccoQ-ccoP -168 5.3 GCTTTGATATGTGTCAAATC RB2654_10029
Roseobacter sp. MED193
Position: -93
Score: 5.52162
Locus tag: MED193_11228
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: MED193_11223
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: MED193_11218
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: MED193_11213
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
ccoN-ccoO-ccoQ-ccoP -93 5.5 GTCTTGATGCAGATCAATGC MED193_11228
Roseovarius sp. 217
Position: -143
Score: 5.40991
Position: -111
Score: 5.43901
Locus tag: ROS217_12226
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: ROS217_12231
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: ROS217_12236
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: ROS217_12241
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
ccoN-ccoO-ccoQ-ccoP -143 5.4 GCCTTGACGCGGATCAAACG ROS217_12226
Silicibacter TM1040
Position: -117
Score: 5.39391
Locus tag: TM1040_2545
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: TM1040_2544
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: TM1040_2543
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: TM1040_2542
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
ccoN-ccoO-ccoQ-ccoP -117 5.4 ATCTTGATACAGATCAATGT TM1040_2545
Silicibacter pomeroyi DSS-3
Position: -110
Score: 5.66391
Locus tag: SPO3526
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: SPO3525
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: SPO3524
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: SPO3523
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
ccoN-ccoO-ccoQ-ccoP -110 5.7 GTCTTGATGCAGATCAAAGC SPO3526
Sulfitobacter sp. EE-36
Position: -72
Score: 5.72861
Locus tag: EE36_02238
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC
Locus tag: EE36_02233
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC
Locus tag: EE36_02228
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC
Locus tag: EE36_02223
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC
ccoN-ccoO-ccoQ-ccoP -72 5.7 CATTTGATCTAGATCAAGGC EE36_02238