Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ccpR gene

Properties
Regulog: FnrN - Rhodobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 85 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Paracoccus denitrificans PD1222
Position: -141
Score: 5.05381
Sequence: CATCTGACCCAGATCAAAGC
Locus tag: Pden_0893
Name: ccpR
Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
ccpR -141 5.1 CATCTGACCCAGATCAAAGC Pden_0893
Rhodobacter sphaeroides 2.4.1
Position: -81
Score: 5.23608
Sequence: GAATTGATCTAAGTCAAAGG
Locus tag: RSP_2395
Name: ccpR
Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
ccpR -81 5.2 GAATTGATCTAAGTCAAAGG RSP_2395
Silicibacter pomeroyi DSS-3
Position: -96
Score: 5.49363
Sequence: CGCTTGATCCATATCAAAGT
Locus tag: SPO0330
Name: ccpR
Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
ccpR -96 5.5 CGCTTGATCCATATCAAAGT SPO0330