Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ompW gene

Properties
Regulog: FnrN - Rhodobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 85 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Paracoccus denitrificans PD1222
Position: -51
Score: 5.48362
Sequence: ATCTTGATCCAGATCAACGT
Locus tag: Pden_3636
Name: ompW
Funciton: Outer membrane protein W precursor
ompW -51 5.5 ATCTTGATCCAGATCAACGT Pden_3636
Rhodobacter sphaeroides 2.4.1
Position: -69
Score: 5.41025
Sequence: CCATTGACGCAGATCAAGGC
Locus tag: RSP_2507
Name: ompW
Funciton: Outer membrane protein W precursor
ompW -69 5.4 CCATTGACGCAGATCAAGGC RSP_2507
Roseovarius sp. 217
Position: -75
Score: 5.21525
Sequence: AACTTGACCCAAATCAATGT
Locus tag: ROS217_20807
Name: ompW
Funciton: Outer membrane protein W precursor
ompW -75 5.2 AACTTGACCCAAATCAATGT ROS217_20807
Silicibacter TM1040
Position: -78
Score: 5.21265
Sequence: CATTTGATCTAGATCAGAGC
Locus tag: TM1040_0734
Name: ompW
Funciton: Outer membrane protein W precursor
ompW -78 5.2 CATTTGATCTAGATCAGAGC TM1040_0734
Silicibacter pomeroyi DSS-3
Position: -75
Score: 5.20071
Sequence: ATCTTGATCCAGATCAGGGA
Locus tag: SPO2792
Name: ompW
Funciton: Outer membrane protein W precursor
ompW -75 5.2 ATCTTGATCCAGATCAGGGA SPO2792