Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing hemN gene

Properties
Regulog: FnrN - Rhodobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 85 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -51
Score: 5.39772
Sequence: CGCTTGATCCAAATCAATGC
Locus tag: Jann_3859
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN -51 5.4 CGCTTGATCCAAATCAATGC Jann_3859
Paracoccus denitrificans PD1222
Position: -51
Score: 5.31016
Sequence: CATTTGATTTGGGTCAAGGT
Locus tag: Pden_1851
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN -51 5.3 CATTTGATTTGGGTCAAGGT Pden_1851
Rhodobacter sphaeroides 2.4.1
Position: -51
Score: 5.54002
Sequence: CGCTTGATCTGAATCAAAGC
Locus tag: RSP_0699
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN -51 5.5 CGCTTGATCTGAATCAAAGC RSP_0699
Rhodobacterales bacterium HTCC2654
Position: -52
Score: 5.34302
Sequence: CATTTGATCCGTATCAATGT
Locus tag: RB2654_10049
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN -52 5.3 CATTTGATCCGTATCAATGT RB2654_10049
Roseovarius sp. 217
Position: -51
Score: 5.30224
Sequence: CGGTTGATCTAAATCAAAGC
Locus tag: ROS217_12211
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN -51 5.3 CGGTTGATCTAAATCAAAGC ROS217_12211
Silicibacter TM1040
Position: -51
Score: 5.20421
Sequence: TGGTTGATCTGTGTCAAAGC
Locus tag: TM1040_2548
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN -51 5.2 TGGTTGATCTGTGTCAAAGC TM1040_2548
Silicibacter pomeroyi DSS-3
Position: -52
Score: 5.35098
Sequence: TACTTGATCTGAGTCAAGGT
Locus tag: SPO3532
Name: hemN
Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
hemN -52 5.4 TACTTGATCTGAGTCAAGGT SPO3532