Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ctaD gene

Properties
Regulog: FnrN - Rhodobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 85 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanicola batsensis HTCC2597
Position: -113
Score: 5.17196
Sequence: TATTTGATCTGCGTCAATAC
Locus tag: OB2597_06915
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaD -113 5.2 TATTTGATCTGCGTCAATAC OB2597_06915
Rhodobacter sphaeroides 2.4.1
Position: -127
Score: 5.61574
Sequence: TTATTGATCCAGATCAAAGT
Locus tag: RSP_1877
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaD -127 5.6 TTATTGATCCAGATCAAAGT RSP_1877
Rhodobacterales bacterium HTCC2654
Position: -212
Score: 5.59745
Sequence: TCCTTGACCCGGATCAAACA
Locus tag: RB2654_08222
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaD -212 5.6 TCCTTGACCCGGATCAAACA RB2654_08222
Roseobacter sp. MED193
Position: -122
Score: 5.59622
Sequence: ATCTTGATCCAGATCAAACT
Locus tag: MED193_08728
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaD -122 5.6 ATCTTGATCCAGATCAAACT MED193_08728
Roseovarius sp. 217
Position: -128
Score: 5.422
Sequence: TCTTTGATCTGCATCAATTT
Locus tag: ROS217_15111
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaD -128 5.4 TCTTTGATCTGCATCAATTT ROS217_15111
Silicibacter TM1040
Position: -125
Score: 5.60344
Sequence: TTCTTGATCCAGATCAAACT
Locus tag: TM1040_2291
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaD -125 5.6 TTCTTGATCCAGATCAAACT TM1040_2291
Silicibacter pomeroyi DSS-3
Position: -120
Score: 5.59622
Sequence: ATCTTGATCCAGATCAAACT
Locus tag: SPO1383
Name: ctaD
Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaD -120 5.6 ATCTTGATCCAGATCAAACT SPO1383