Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing fnrN gene

Properties
Regulog: FnrN - Rhodobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 85 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -56
Score: 5.39772
Sequence: GCATTGATTTGGATCAAGCG
Locus tag: Jann_3858
Name: fnrN
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
fnrN -56 5.4 GCATTGATTTGGATCAAGCG Jann_3858
Paracoccus denitrificans PD1222
Position: -131
Score: 5.31016
Sequence: ACCTTGACCCAAATCAAATG
Locus tag: Pden_1850
Name: fnrN
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
fnrN -131 5.3 ACCTTGACCCAAATCAAATG Pden_1850
Rhodobacter sphaeroides 2.4.1
Position: -31
Score: 5.54002
Sequence: GCTTTGATTCAGATCAAGCG
Locus tag: RSP_0698
Name: fnrN
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
fnrN -31 5.5 GCTTTGATTCAGATCAAGCG RSP_0698
Rhodobacterales bacterium HTCC2654
Position: -29
Score: 5.34302
Sequence: ACATTGATACGGATCAAATG
Locus tag: RB2654_10044
Name: fnrN
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
fnrN -29 5.3 ACATTGATACGGATCAAATG RB2654_10044
Roseobacter sp. MED193
Position: -29
Score: 5.34421
Sequence: ACTTTGACTTGGATCAAACG
Locus tag: MED193_11238
Name: fnrN
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
fnrN -29 5.3 ACTTTGACTTGGATCAAACG MED193_11238
Roseovarius sp. 217
Position: -53
Score: 5.30224
Sequence: GCTTTGATTTAGATCAACCG
Locus tag: ROS217_12216
Name: fnrN
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
fnrN -53 5.3 GCTTTGATTTAGATCAACCG ROS217_12216
Silicibacter TM1040
Position: -29
Score: 5.20421
Sequence: GCTTTGACACAGATCAACCA
Locus tag: TM1040_2547
Name: fnrN
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
fnrN -29 5.2 GCTTTGACACAGATCAACCA TM1040_2547
Silicibacter pomeroyi DSS-3
Position: -32
Score: 5.35098
Sequence: ACCTTGACTCAGATCAAGTA
Locus tag: SPO3531
Name: fnrN
Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
fnrN -32 5.4 ACCTTGACTCAGATCAAGTA SPO3531