Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing hemA gene

Properties
Regulog: FnrN - Rhodobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 85 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -67
Score: 5.90163
Sequence: CCTTTGATCCAGATCAAAGC
Locus tag: Jann_1933
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA -67 5.9 CCTTTGATCCAGATCAAAGC Jann_1933
Loktanella vestfoldensis SKA53
Position: -167
Score: 4.92982
Sequence: TTATTGATCCAGATCATGGT
Locus tag: SKA53_02751
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA -167 4.9 TTATTGATCCAGATCATGGT SKA53_02751
Oceanicola batsensis HTCC2597
Position: -155
Score: 5.25378
Sequence: GAATTGATTCACATCAAGGA
Locus tag: OB2597_01932
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA -155 5.3 GAATTGATTCACATCAAGGA OB2597_01932
Paracoccus denitrificans PD1222
Position: -40
Score: 5.39969
Sequence: GGCTTGATGCGTATCAAGGT
Locus tag: Pden_1822
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA -40 5.4 GGCTTGATGCGTATCAAGGT Pden_1822
Rhodobacter sphaeroides 2.4.1
Position: -87
Score: 5.19841
Sequence: GATTTGATCCTTATCAAGGC
Locus tag: RSP_2984
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA -87 5.2 GATTTGATCCTTATCAAGGC RSP_2984
Rhodobacterales bacterium HTCC2654
Position: -127
Score: 5.27211
Sequence: GGTTTGATCCACGTCAACGC
Locus tag: RB2654_03389
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA -127 5.3 GGTTTGATCCACGTCAACGC RB2654_03389
Roseobacter sp. MED193
Position: -162
Score: 5.38476
Sequence: TATTTGACCTGTATCAAAGT
Locus tag: MED193_21064
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA -162 5.4 TATTTGACCTGTATCAAAGT MED193_21064
Roseovarius sp. 217
Position: -168
Score: 5.24657
Sequence: GACTTGACCCAAGTCAAGGA
Locus tag: ROS217_21737
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA -168 5.2 GACTTGACCCAAGTCAAGGA ROS217_21737
Silicibacter TM1040
Position: -169
Score: 5.37819
Sequence: TATTTGACCTGTATCAAGGA
Locus tag: TM1040_0860
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA -169 5.4 TATTTGACCTGTATCAAGGA TM1040_0860
Silicibacter pomeroyi DSS-3
Position: -146
Score: 5.11806
Sequence: TAATTGACCCAAGTCAAGGC
Locus tag: SPO2596
Name: hemA
Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
hemA -146 5.1 TAATTGACCCAAGTCAAGGC SPO2596