Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing uspA gene

Properties
Regulog: FnrN - Rhodobacterales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Built upon 85 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Loktanella vestfoldensis SKA53
Position: -136
Score: 5.13034
Sequence: TCGTTGATGTGGATCAACCC
Position: -114
Score: 5.2607
Sequence: CGTTTGACATGGATCAATGC
Locus tag: SKA53_08751
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA -136 5.1 TCGTTGATGTGGATCAACCC SKA53_08751
-114 5.3 CGTTTGACATGGATCAATGC
Oceanicola granulosus HTCC2516
Position: -74
Score: 5.92145
Sequence: GCCTTGATCTGGATCAAGGT
Locus tag: OG2516_17525
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA -74 5.9 GCCTTGATCTGGATCAAGGT OG2516_17525
Paracoccus denitrificans PD1222
Position: -146
Score: 5.27804
Sequence: ACTTTGATCTGCGTCAATCT
Locus tag: Pden_1849
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA -146 5.3 ACTTTGATCTGCGTCAATCT Pden_1849
Rhodobacter sphaeroides 2.4.1
Position: -111
Score: 5.38772
Sequence: GCCTTGATCCATGTCAATGG
Position: -79
Score: 5.11642
Sequence: TACTTGATCCTCATCAAGGA
Locus tag: RSP_0697
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA -111 5.4 GCCTTGATCCATGTCAATGG RSP_0697
-79 5.1 TACTTGATCCTCATCAAGGA
Rhodobacterales bacterium HTCC2654
Position: -143
Score: 5.43178
Sequence: ACCTTGATCCATGTCAAAAC
Position: -100
Score: 5.28189
Sequence: GATTTGACACATATCAAAGC
Locus tag: RB2654_10034
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA -143 5.4 ACCTTGATCCATGTCAAAAC RB2654_10034
-100 5.3 GATTTGACACATATCAAAGC
Roseobacter sp. MED193
Position: -114
Score: 5.52162
Sequence: GCATTGATCTGCATCAAGAC
Locus tag: MED193_11233
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA -114 5.5 GCATTGATCTGCATCAAGAC MED193_11233
Roseovarius sp. 217
Position: -111
Score: 5.43901
Sequence: TCCTTGATCTGTGTCAAAAC
Position: -79
Score: 5.40991
Sequence: CGTTTGATCCGCGTCAAGGC
Locus tag: ROS217_12221
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA -111 5.4 TCCTTGATCTGTGTCAAAAC ROS217_12221
-79 5.4 CGTTTGATCCGCGTCAAGGC
Silicibacter TM1040
Position: -126
Score: 5.39391
Sequence: ACATTGATCTGTATCAAGAT
Locus tag: TM1040_2546
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA -126 5.4 ACATTGATCTGTATCAAGAT TM1040_2546
Silicibacter pomeroyi DSS-3
Position: -98
Score: 5.66391
Sequence: GCTTTGATCTGCATCAAGAC
Locus tag: SPO3527
Name: uspA
Funciton: Predicted universal stress protein UspA
uspA -98 5.7 GCTTTGATCTGCATCAAGAC SPO3527