Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing paaI gene

Properties
Regulog: PaaR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces coelicolor A3(2)
Position: -152
Score: 5.47039
Sequence: CCCAACCGACCATTCGTTCGGT
Position: -29
Score: 5.58549
Sequence: GCTAACCGAATGGTCGGTCGGG
Locus tag: SCO7470
Name: paaI
Funciton: Phenylacetic acid degradation protein PaaI, thioesterase
Locus tag: SCO7469
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaI-paaK -152 5.5 CCCAACCGACCATTCGTTCGGT SCO7470
-29 5.6 GCTAACCGAATGGTCGGTCGGG