Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing paaK gene

Properties
Regulog: PaaR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -56
Score: 4.96162
Sequence: GGCTACCGAATGATCGGTCGCC
Locus tag: SAV_1257
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaK -56 5 GGCTACCGAATGATCGGTCGCC SAV_1257
Streptomyces coelicolor A3(2)
Position: -152
Score: 5.47039
Sequence: CCCAACCGACCATTCGTTCGGT
Position: -29
Score: 5.58549
Sequence: GCTAACCGAATGGTCGGTCGGG
Locus tag: SCO7470
Name: paaI
Funciton: Phenylacetic acid degradation protein PaaI, thioesterase
Locus tag: SCO7469
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaI-paaK -152 5.5 CCCAACCGACCATTCGTTCGGT SCO7470
-29 5.6 GCTAACCGAATGGTCGGTCGGG
Streptomyces griseus subsp. griseus NBRC 13350
Position: -77
Score: 5.36556
Sequence: ATCGACCGAATGATCGGTCGCC
Locus tag: SGR_6814
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaK -77 5.4 ATCGACCGAATGATCGGTCGCC SGR_6814
Streptomyces scabiei 87.22
Position: -184
Score: 5.21621
Sequence: CCCAACCGACCATTCGTTCGGG
Position: -52
Score: 5.53762
Sequence: AGCAACCGAATGGTCGGTCGGC
Locus tag: SCAB_82261
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaK -184 5.2 CCCAACCGACCATTCGTTCGGG SCAB_82261
-52 5.5 AGCAACCGAATGGTCGGTCGGC