Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing paaH gene

Properties
Regulog: PaaR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -74
Score: 5.79955
Sequence: AGTAACCGAACGATCGGTCGGG
Locus tag: SAV_4359
Name: paaH
Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Locus tag: SAV_4360
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaH-paaR -74 5.8 AGTAACCGAACGATCGGTCGGG SAV_4359
Streptomyces coelicolor A3(2)
Position: -74
Score: 5.79955
Sequence: AGTAACCGAACGATCGGTCGGG
Locus tag: SCO3834
Name: paaH
Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Locus tag: SCO3833
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaH-paaR -74 5.8 AGTAACCGAACGATCGGTCGGG SCO3834
Streptomyces scabiei 87.22
Position: -74
Score: 5.79955
Sequence: AGTAACCGAACGATCGGTCGGG
Locus tag: SCAB_45341
Name: paaH
Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Locus tag: SCAB_45331
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaH-paaR -74 5.8 AGTAACCGAACGATCGGTCGGG SCAB_45341