Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing paaZ gene

Properties
Regulog: PaaR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -96
Score: 5.79955
Sequence: CCCGACCGATCGTTCGGTTACT
Locus tag: SAV_4358
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaZ -96 5.8 CCCGACCGATCGTTCGGTTACT SAV_4358
Streptomyces coelicolor A3(2)
Position: -106
Score: 5.79955
Sequence: CCCGACCGATCGTTCGGTTACT
Locus tag: SCO3835
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaZ -106 5.8 CCCGACCGATCGTTCGGTTACT SCO3835
Streptomyces griseus subsp. griseus NBRC 13350
Position: -72
Score: 5.79955
Sequence: CCCGACCGATCGTTCGGTTACT
Locus tag: SGR_3745
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaZ -72 5.8 CCCGACCGATCGTTCGGTTACT SGR_3745
Streptomyces scabiei 87.22
Position: -155
Score: 5.79955
Sequence: CCCGACCGATCGTTCGGTTACT
Locus tag: SCAB_45351
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaZ -155 5.8 CCCGACCGATCGTTCGGTTACT SCAB_45351