Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing paaA gene

Regulog: PaaR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -48
Score: 5.80462
Locus tag: SAV_4354
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: SAV_4353
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: SAV_4352
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: SAV_4351
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: SAV_4350
Name: paaE
Funciton: Phenylacetate-CoA oxygenase, PaaE subunit
paaA-paaB-paaC-paaD-paaE -48 5.8 ACCGAACGATCGGTCGGTCGGT SAV_4354
Streptomyces coelicolor A3(2)
Position: -157
Score: 5.58549
Position: -34
Score: 5.47039
Locus tag: SCO7471
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: SCO7472
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: SCO7473
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: SCO7474
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: SCO7475
Name: paaE
Funciton: Phenylacetate-CoA oxygenase, PaaE subunit
paaA-paaB-paaC-paaD-paaE -157 5.6 CCCGACCGACCATTCGGTTAGC SCO7471
Streptomyces griseus subsp. griseus NBRC 13350
Position: -34
Score: 5.62079
Locus tag: SGR_3741
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: SGR_3740
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: SGR_3739
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: SGR_3738
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: SGR_3737
Name: paaE
Funciton: Phenylacetate-CoA oxygenase, PaaE subunit
paaA-paaB-paaC-paaD-paaE -34 5.6 AGGAACCGAACGATCGGTCGGT SGR_3741
Streptomyces scabiei 87.22
Position: -166
Score: 5.53762
Position: -34
Score: 5.21621
Locus tag: SCAB_82281
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: SCAB_82291
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: SCAB_82301
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: SCAB_82311
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: SCAB_82321
Name: paaE
Funciton: Phenylacetate-CoA oxygenase, PaaE subunit
paaA-paaB-paaC-paaD-paaE -166 5.5 GCCGACCGACCATTCGGTTGCT SCAB_82281