Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing bkdC gene

Properties
Regulog: PaaR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -77
Score: 5.59368
Sequence: GACGACCGAACAATCGGTAGGT
Locus tag: SAV_4362
Name: bkdA
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
Locus tag: SAV_4363
Name: bkdB
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
Locus tag: SAV_4364
Name: bkdC
Funciton: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
bkdA-bkdB-bkdC -77 5.6 GACGACCGAACAATCGGTAGGT SAV_4362
Streptomyces coelicolor A3(2)
Position: -78
Score: 5.59368
Sequence: GACGACCGAACAATCGGTAGGT
Locus tag: SCO3831
Name: bkdA
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
Locus tag: SCO3830
Name: bkdB
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
Locus tag: SCO3829
Name: bkdC
Funciton: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
bkdA-bkdB-bkdC -78 5.6 GACGACCGAACAATCGGTAGGT SCO3831
Streptomyces griseus subsp. griseus NBRC 13350
Position: -127
Score: 5.52512
Sequence: CGCGACCGAACAATCGGTAGGT
Locus tag: SGR_3748
Name: bkdA
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
Locus tag: SGR_3749
Name: bkdB
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
Locus tag: SGR_3750
Name: bkdC
Funciton: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
bkdA-bkdB-bkdC -127 5.5 CGCGACCGAACAATCGGTAGGT SGR_3748
Streptomyces scabiei 87.22
Position: -77
Score: 5.87908
Sequence: AACGACCGAACAATCGGTAGGT
Locus tag: SCAB_45311
Name: bkdA
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
Locus tag: SCAB_45301
Name: bkdB
Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
Locus tag: SCAB_45291
Name: bkdC
Funciton: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
bkdA-bkdB-bkdC -77 5.9 AACGACCGAACAATCGGTAGGT SCAB_45311