Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rpmG2 gene

Regulog: Zur - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 19 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -31
Score: 5.68699
Locus tag: SAV_4643
Name: rpmG2
Funciton: LSU ribosomal protein L33p
Locus tag: SAV_4644
Name: rpmE2
Funciton: LSU ribosomal protein L31p
Locus tag: SAV_4645
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: SAV_4646
Name: rpsR2
Funciton: SSU ribosomal protein S18p
rpmG2-rpmE2-yciC-rpsR2 -31 5.7 AAATGGAAGTCGTTTTCAGTA SAV_4643
Streptomyces coelicolor A3(2)
Position: -31
Score: 5.89251
Locus tag: SCO3428
Name: rpmG2
Funciton: LSU ribosomal protein L33p
Locus tag: SCO3427
Name: rpmE2
Funciton: LSU ribosomal protein L31p
Locus tag: SCO3426
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: SCO3425
Name: rpsR2
Funciton: SSU ribosomal protein S18p
rpmG2-rpmE2-yciC-rpsR2 -31 5.9 TAATGGAATTCATTTTCAGTA SCO3428
Streptomyces griseus subsp. griseus NBRC 13350
Position: -31
Score: 5.64458
Locus tag: SGR_546
Name: rpmG2
Funciton: LSU ribosomal protein L33p
Locus tag: SGR_547
Name: rpmE2
Funciton: LSU ribosomal protein L31p
Locus tag: SGR_548
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: SGR_549
Name: rpsR2
Funciton: SSU ribosomal protein S18p
rpmG2-rpmE2-yciC-rpsR2 -31 5.6 AAATGGAAACCATTGCCATAT SGR_546
Streptomyces scabiei 87.22
Position: -31
Score: 5.89902
Locus tag: SCAB_40001
Name: rpmG2
Funciton: LSU ribosomal protein L33p
Locus tag: SCAB_39991
Name: rpmE2
Funciton: LSU ribosomal protein L31p
Locus tag: SCAB_39981
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: SCAB_39971
Name: rpsR2
Funciton: SSU ribosomal protein S18p
rpmG2-rpmE2-yciC-rpsR2 -31 5.9 AAATGGAATTCATTTTCAGTA SCAB_40001