Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rpmB2 gene

Properties
Regulog: Zur - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 19 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -75
Score: 5.68699
Sequence: TACTGAAAACGACTTCCATTT
Locus tag: SAV_4642
Name: rpmB2
Funciton: LSU ribosomal protein L28p
Locus tag: SAV_4641
Name: rpsN2
Funciton: SSU ribosomal protein S14p
Locus tag: SAV_4640
Name: SC03431
Funciton: possible membrane protein
rpmB2-rpsN2-SC03431 -75 5.7 TACTGAAAACGACTTCCATTT SAV_4642
Streptomyces coelicolor A3(2)
Position: -62
Score: 5.89251
Sequence: TACTGAAAATGAATTCCATTA
Locus tag: SCO3429
Name: rpmB2
Funciton: LSU ribosomal protein L28p
Locus tag: SCO3430
Name: rpsN2
Funciton: SSU ribosomal protein S14p
Locus tag: SCO3431
Name: SC03431
Funciton: possible membrane protein
rpmB2-rpsN2-SC03431 -62 5.9 TACTGAAAATGAATTCCATTA SCO3429
Streptomyces griseus subsp. griseus NBRC 13350
Position: -58
Score: 5.64458
Sequence: ATATGGCAATGGTTTCCATTT
Locus tag: SGR_545
Name: rpmB2
Funciton: LSU ribosomal protein L28p
Locus tag: SGR_544
Name: rpsN2
Funciton: SSU ribosomal protein S14p
rpmB2-rpsN2 -58 5.6 ATATGGCAATGGTTTCCATTT SGR_545
Streptomyces scabiei 87.22
Position: -66
Score: 5.89902
Sequence: TACTGAAAATGAATTCCATTT
Locus tag: SCAB_40011
Name: rpmB2
Funciton: LSU ribosomal protein L28p
Locus tag: SCAB_40021
Name: rpsN2
Funciton: SSU ribosomal protein S14p
Locus tag: SCAB_40031
Name: SC03431
Funciton: possible membrane protein
rpmB2-rpsN2-SC03431 -66 5.9 TACTGAAAATGAATTCCATTT SCAB_40011