Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rpmF2 gene

Properties
Regulog: Zur - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 19 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces coelicolor A3(2)
Position: -56
Score: 4.99167
Sequence: ACATGAACATCGTTTTCATGT
Locus tag: SCO0436
Name: rpmF2
Funciton: LSU ribosomal protein L32p
rpmF2 -56 5 ACATGAACATCGTTTTCATGT SCO0436
Streptomyces scabiei 87.22
Position: -64
Score: 5.11035
Sequence: TAATGGGATCCATTTTCATGT
Locus tag: SCAB_41531
Name: rpmF2
Funciton: LSU ribosomal protein L32p
rpmF2 -64 5.1 TAATGGGATCCATTTTCATGT SCAB_41531