Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing SCO0474 gene

Properties
Regulog: Zur - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 19 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces coelicolor A3(2)
Position: -34
Score: 4.8663
Sequence: TGTTGAACATGATTTTCATTG
Locus tag: SCO0475
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SCO0474
Name: SCO0474
Funciton: WD40/YVTN repeat-like-containing domain
Locus tag: SCO0473
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SCO0472
Name: SCO0472
Funciton: WD40/YVTN repeat-like-containing domain
znuB2-SCO0474-znuA2-SCO0472 -34 4.9 TGTTGAACATGATTTTCATTG SCO0475