Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing znuA gene

Regulog: Zur - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 19 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -39
Score: 5.26889
Position: -17
Score: 4.81695
Locus tag: SAV_5634
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SAV_5633
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SAV_5632
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SAV_5631
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuA-znuC-znuB-zur -39 5.3 TGTTGACAATCGTTTCCAGTT SAV_5634
Streptomyces coelicolor A3(2)
Position: -39
Score: 5.0155
Position: -17
Score: 4.57249
Locus tag: SCO2505
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SCO2506
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SCO2507
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SCO2508
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuA-znuC-znuB-zur -39 5 TGTTGACAACGGTTTCCATAT SCO2505
Streptomyces griseus subsp. griseus NBRC 13350
Position: -39
Score: 4.96135
Position: -17
Score: 4.579
Locus tag: SGR_5019
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SGR_5018
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SGR_5017
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SGR_5016
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuA-znuC-znuB-zur -39 5 TGTTGACAATCGTTTCCACTT SGR_5019
Streptomyces scabiei 87.22
Position: -39
Score: 5.03163
Position: -17
Score: 5.05355
Locus tag: SCAB_61981
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SCAB_61971
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SCAB_61961
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SCAB_61951
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuA-znuC-znuB-zur -39 5 TGTTGACAATCGTTTCCAGAT SCAB_61981