Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing arsD gene

Properties
Regulog: ArsR - Nocardiaceae
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite; Arsenate
Phylum: Actinobacteria
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodococcus erythropolis PR4
Position: -28
Score: 6.92377
Sequence: TCAATATTGATGTATGTCGA
Locus tag: pREL1_0158
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: pREL1_0159
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pREL1_0160
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pREL1_0161
Name: trxB
Funciton: Thioredoxin reductase (EC 1.8.1.9)
Locus tag: pREL1_0162
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pREL1_0163
Name: pREL1_0163
Funciton: Monooxygenase, putative
Locus tag: pREL1_0164
Name: arsD
Funciton: Arsenical resistance operon trans-acting repressor arsD
Locus tag: pREL1_0165
Name: arsA
Funciton: Arsenical pump-driving ATPase (EC 3.6.3.16)
arsR-arsB-arsC-trxB-arsC-pREL1_0163-arsD-arsA -28 6.9 TCAATATTGATGTATGTCGA pREL1_0158
Rhodococcus opacus B4
Position: -13
Score: 7.18905
Sequence: TCAATATCGACGTATGTCGA
Locus tag: ROP_00150
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: ROP_00160
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00170
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00180
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00190
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00200
Name: arsD
Funciton: Arsenical resistance operon trans-acting repressor arsD
Locus tag: ROP_00210
Name: arsA
Funciton: Arsenical pump-driving ATPase (EC 3.6.3.16)
arsR-arsB-arsC-arsC-arsC-arsD-arsA -13 7.2 TCAATATCGACGTATGTCGA ROP_00150