Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing arsR gene

Properties
Regulog: ArsR - Nocardiaceae
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite; Arsenate
Phylum: Actinobacteria
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Nocardia farcinica IFM 10152
Position: -13
Score: 6.46324
Sequence: TCAATATCGATGCATGTCTA
Locus tag: nfa24490
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: nfa24500
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: nfa24510
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR-arsB-arsC -13 6.5 TCAATATCGATGCATGTCTA nfa24490
Rhodococcus erythropolis PR4
Position: -13
Score: 6.90937
Sequence: TCAATATCGAAGAATGTCGA
Locus tag: RER_35210
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: RER_35200
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: RER_35190
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR-arsB-arsC -13 6.9 TCAATATCGAAGAATGTCGA RER_35210
Rhodococcus opacus B4
Position: -13
Score: 7.12383
Sequence: TCAATATCGACGCATGTCGA
Locus tag: ROP_29950
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: ROP_29960
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_29970
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR-arsB-arsC -13 7.1 TCAATATCGACGCATGTCGA ROP_29950
Rhodococcus sp. RHA1
Position: -13
Score: 7.12383
Sequence: TCAATATCGACGCATGTCGA
Locus tag: RHA1_ro03367
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: RHA1_ro03368
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: RHA1_ro03369
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR-arsB-arsC -13 7.1 TCAATATCGACGCATGTCGA RHA1_ro03367