Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing arsB gene

Properties
Regulog: ArsR - Nocardiaceae
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite; Arsenate
Phylum: Actinobacteria
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Nocardia farcinica IFM 10152
Position: -13
Score: 6.75266
Sequence: TCAATATTGGCGTATGTCGA
Locus tag: pnf2240
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: pnf2250
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pnf2260
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pnf2270
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pnf2280
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR-arsB-arsC-arsC-arsC -13 6.8 TCAATATTGGCGTATGTCGA pnf2240
Rhodococcus erythropolis PR4
Position: -13
Score: 6.90937
Sequence: TCAATATCGAAGAATGTCGA
Locus tag: RER_35210
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: RER_35200
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: RER_35190
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR-arsB-arsC -13 6.9 TCAATATCGAAGAATGTCGA RER_35210
Rhodococcus opacus B4
Position: -13
Score: 7.18905
Sequence: TCAATATCGACGTATGTCGA
Locus tag: ROP_00150
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: ROP_00160
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00170
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00180
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00190
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00200
Name: arsD
Funciton: Arsenical resistance operon trans-acting repressor arsD
Locus tag: ROP_00210
Name: arsA
Funciton: Arsenical pump-driving ATPase (EC 3.6.3.16)
arsR-arsB-arsC-arsC-arsC-arsD-arsA -13 7.2 TCAATATCGACGTATGTCGA ROP_00150
Rhodococcus sp. RHA1
Position: -13
Score: 7.12383
Sequence: TCAATATCGACGCATGTCGA
Locus tag: RHA1_ro03367
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: RHA1_ro03368
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: RHA1_ro03369
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR-arsB-arsC -13 7.1 TCAATATCGACGCATGTCGA RHA1_ro03367