Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing garK gene

Regulog: SdaR - Vibrionales
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Proteobacteria/Gamma
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -171
Score: 6.67182
Locus tag: PBPRA3189
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: PBPRA3190
Name: garK
Funciton: Glycerate kinase (EC
Vibrio cholerae O1 biovar eltor str. N16961
Position: -158
Score: 6.39229
Locus tag: VCA0904
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: VCA0903
Name: garK
Funciton: Glycerate kinase (EC
Vibrio fischeri ES114
Position: -121
Score: 6.61858
Locus tag: VF_2156
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: VF_2157
Name: garK
Funciton: Glycerate kinase (EC
Vibrio harveyi ATCC BAA-1116
Position: -144
Score: 6.48883
Locus tag: VIBHAR_06863
Name: garK
Funciton: Glycerate kinase (EC
Vibrio parahaemolyticus RIMD 2210633
Position: -158
Score: 6.83552
Locus tag: VPA0116
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: VPA0117
Name: garK
Funciton: Glycerate kinase (EC
Vibrio salmonicida LFI1238
Position: -121
Score: 6.02831
Locus tag: VSAL_I2593
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: VSAL_I2594
Name: garK
Funciton: Glycerate kinase (EC
Vibrio vulnificus CMCP6
Position: -129
Score: 6.54506
Locus tag: VV1_1655
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: VV1_1654
Name: garK
Funciton: Glycerate kinase (EC
grtP-garK -129 6.5 AATTGTGCAGATGCACAAAA VV1_1655