Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing tctC gene

Properties
Regulog: GudR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Glucarate utilization
Effector:
Phylum: Proteobacteria/Beta
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Polaromonas sp. JS666
Position: -79
Score: 5.88688
Sequence: AATTGTTAGCGCTAACATTC
Locus tag: Bpro_4526
Name: tctC
Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
tctC -79 5.9 AATTGTTAGCGCTAACATTC Bpro_4526