Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing gudR gene

Properties
Regulog: GudR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Glucarate utilization
Effector:
Phylum: Proteobacteria/Beta
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acidovorax avenae subsp. citrulli AAC00-1
Position: -110
Score: 5.87948
Sequence: GGATGTTAACGTTAACATCC
Locus tag: Aave_3625
Name: gudR
Funciton: Predicted D-glucarate utilization regulator, LacI family
gudR -110 5.9 GGATGTTAACGTTAACATCC Aave_3625
Methylibium petroleiphilum PM1
Position: -36
Score: 5.47034
Sequence: GGATGGTAGCGGTGTCATCT
Locus tag: Mpe_A0968
Name: gudR
Funciton: Predicted D-glucarate utilization regulator, LacI family
gudR -36 5.5 GGATGGTAGCGGTGTCATCT Mpe_A0968
Polaromonas sp. JS666
Position: -24
Score: 4.89221
Sequence: GCAAGTTAGCGTTAACATCA
Locus tag: Bpro_4527
Name: gudR
Funciton: Predicted D-glucarate utilization regulator, LacI family
gudR -24 4.9 GCAAGTTAGCGTTAACATCA Bpro_4527