Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing kgsD gene

Properties
Regulog: GudR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Glucarate utilization
Effector:
Phylum: Proteobacteria/Beta
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Polaromonas sp. JS666
Position: -29
Score: 5.98784
Sequence: AAAAGGTAGCGCTACCATTC
Position: -2
Score: 5.50353
Sequence: CAATGGTAGCGCTACCTTTA
Locus tag: Bpro_3419
Name: kdgD
Funciton: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
Locus tag: Bpro_3420
Name: tctC4
Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
Locus tag: Bpro_3421
Name: gudD
Funciton: Glucarate dehydratase (EC 4.2.1.40)
Locus tag: Bpro_3422
Name: kgsD
Funciton: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
kdgD-tctC4-gudD-kgsD -29 6 AAAAGGTAGCGCTACCATTC Bpro_3419
-2 5.5 CAATGGTAGCGCTACCTTTA