Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing aroG gene

Properties
Regulog: TyrR - Vibrionales
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio parahaemolyticus RIMD 2210633
Position: -222
Score: 5.43218
Sequence: GTGTAAATATTATTTTACGA
Locus tag: VPA1185
Name: aroG
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
aroG -222 5.4 GTGTAAATATTATTTTACGA VPA1185
Vibrio splendidus LGP32
Position: -190
Score: 5.13493
Sequence: GTGTAAATAATGTTATACGG
Locus tag: VS_II0387
Name: aroG
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
aroG -190 5.1 GTGTAAATAATGTTATACGG VS_II0387
Vibrio vulnificus CMCP6
Position: -184
Score: 5.3662
Sequence: GTGTAATTATTTTTTTACAT
Locus tag: VV20558
Name: aroG
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
aroG -184 5.4 GTGTAATTATTTTTTTACAT VV20558