Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing COG1284 gene

Properties
Regulog: TyrR - Vibrionales
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -106
Score: 5.6516
Sequence: ATGTAAAAAAATCATTACAG
Locus tag: PBPRA0794
Name: COG1284
Funciton: Conserved hypothetical protein
COG1284 -106 5.7 ATGTAAAAAAATCATTACAG PBPRA0794
Vibrio angustum S14
Position: -106
Score: 6.02388
Sequence: GTGTAAAAAATATATTACAG
Locus tag: VAS14_16576
Name: COG1284
Funciton: Conserved hypothetical protein
COG1284 -106 6 GTGTAAAAAATATATTACAG VAS14_16576
Vibrio shilonii AK1
Position: -111
Score: 5.08524
Sequence: GTGTAAAATTTGAATTACAT
Locus tag: VSAK1_10508
Name: COG1284
Funciton: Conserved hypothetical protein
COG1284 -111 5.1 GTGTAAAATTTGAATTACAT VSAK1_10508
Vibrio vulnificus CMCP6
Position: -112
Score: 4.70442
Sequence: CTGTAAAACAACAATTACAT
Locus tag: VV1_0287
Name: COG1284
Funciton: Conserved hypothetical protein
COG1284 -112 4.7 CTGTAAAACAACAATTACAT VV1_0287