Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing tyrP gene

Properties
Regulog: TyrR - Vibrionales
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -224
Score: 5.95394
Sequence: ATGTAAATATAAGTTTACAT
Position: -37
Score: 4.5406
Sequence: GTGTAAAGTTTTATGAACAT
Locus tag: PBPRA2465
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP -224 6 ATGTAAATATAAGTTTACAT PBPRA2465
-37 4.5 GTGTAAAGTTTTATGAACAT
Vibrio angustum S14
Position: -312
Score: 5.5872
Sequence: ACGTAAATATAAATTTACAT
Position: -125
Score: 5.92656
Sequence: ATGTAACTAAAAGTTTACAC
Locus tag: VAS14_18444
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP -312 5.6 ACGTAAATATAAATTTACAT VAS14_18444
-125 5.9 ATGTAACTAAAAGTTTACAC
Vibrio cholerae O1 biovar eltor str. N16961
Position: -168
Score: 6.07461
Sequence: GTGTAAATTATTAATTACAG
Position: -20
Score: 5.04535
Sequence: ATGTATAAAAGAGTTTACAC
Locus tag: VCA0772
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP -168 6.1 GTGTAAATTATTAATTACAG VCA0772
-20 5 ATGTATAAAAGAGTTTACAC
Vibrio fischeri ES114
Position: -132
Score: 6.0843
Sequence: GTGTAAACATATAATTACAG
Locus tag: VF_1197
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP -132 6.1 GTGTAAACATATAATTACAG VF_1197
Vibrio harveyi ATCC BAA-1116
Position: -287
Score: 5.49443
Sequence: GTGTATAAAATAGTTTACAC
Position: -139
Score: 5.20094
Sequence: CTGTAAAGATAAATATACAA
Locus tag: VIBHAR_02530
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP -287 5.5 GTGTATAAAATAGTTTACAC VIBHAR_02530
-139 5.2 CTGTAAAGATAAATATACAA
Vibrio parahaemolyticus RIMD 2210633
Position: -167
Score: 6.12589
Sequence: GTGTAAATATAATTTTACGG
Position: -19
Score: 5.38782
Sequence: ATGTAAAGATAAATATACAA
Locus tag: VP1426
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP -167 6.1 GTGTAAATATAATTTTACGG VP1426
-19 5.4 ATGTAAAGATAAATATACAA
Vibrio salmonicida LFI1238
Position: -117
Score: 5.29795
Sequence: TTGTAATAATAAGTTTACAC
Locus tag: VSAL_I1774
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP -117 5.3 TTGTAATAATAAGTTTACAC VSAL_I1774
Vibrio shilonii AK1
Position: -165
Score: 5.05224
Sequence: CTGTAAACACACTTTTACAC
Position: -144
Score: 4.62006
Sequence: AGATAAATTTATGTTTACAT
Locus tag: VSAK1_15307
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP -165 5.1 CTGTAAACACACTTTTACAC VSAK1_15307
-144 4.6 AGATAAATTTATGTTTACAT
Vibrio splendidus LGP32
Position: -163
Score: 5.08647
Sequence: CTGTACATATTAATATACAG
Position: -144
Score: 4.50959
Sequence: GTGGATATTTTTAATTACAT
Locus tag: VS_II0802
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP -163 5.1 CTGTACATATTAATATACAG VS_II0802
-144 4.5 GTGGATATTTTTAATTACAT
Vibrio vulnificus CMCP6
Position: -169
Score: 4.92431
Sequence: GTGTATTATTAAGTTTACAC
Position: -21
Score: 4.81915
Sequence: CCGTAAATATAAGAATACAC
Locus tag: VV1_2293
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP -169 4.9 GTGTATTATTAAGTTTACAC VV1_2293
-21 4.8 CCGTAAATATAAGAATACAC