Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing tyrR gene

Properties
Regulog: TyrR - Vibrionales
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio angustum S14
Position: -147
Score: 4.60277
Sequence: GTGTAAACTCATATTAATAC
Locus tag: VAS14_00826
Name: tyrR
Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
tyrR -147 4.6 GTGTAAACTCATATTAATAC VAS14_00826
Vibrio fischeri ES114
Position: -41
Score: 5.61476
Sequence: GTGTAAACATATTTTGACAC
Locus tag: VF_A0751
Name: tyrR
Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
tyrR -41 5.6 GTGTAAACATATTTTGACAC VF_A0751
Vibrio salmonicida LFI1238
Position: -41
Score: 5.16865
Sequence: CTGTAAACATATTGTGACAC
Locus tag: VSAL_II0864
Name: tyrR
Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
tyrR -41 5.2 CTGTAAACATATTGTGACAC VSAL_II0864
Vibrio splendidus LGP32
Position: -93
Score: 4.91318
Sequence: GAGTAAACATATGTTTACTC
Locus tag: VS_1793
Name: tyrR
Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
tyrR -93 4.9 GAGTAAACATATGTTTACTC VS_1793