Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing acsA gene

Properties
Regulog: TyrR - Vibrionales
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -321
Score: 5.67525
Sequence: GTGTAACATAAATTTTACAT
Position: -164
Score: 4.30387
Sequence: ATGTAAAATATTCAACACAC
Locus tag: PBPRB1165
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: PBPRB1166
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: PBPRB1167
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
Locus tag: PBPRB1168
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
hmgA-hmgC-hmgB-acsA -321 5.7 GTGTAACATAAATTTTACAT PBPRB1165
-164 4.3 ATGTAAAATATTCAACACAC
Vibrio angustum S14
Position: -109
Score: 4.19535
Sequence: TTGTAAACAAGAATGAACAT
Locus tag: VAS14_11214
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VAS14_11209
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VAS14_11204
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
Locus tag: VAS14_11199
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
hmgA-hmgC-hmgB-acsA -109 4.2 TTGTAAACAAGAATGAACAT VAS14_11214
Vibrio cholerae O1 biovar eltor str. N16961
Position: -144
Score: 5.36978
Sequence: ATGTAACAATAATTTTACAA
Locus tag: VCA0829
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
acsA -144 5.4 ATGTAACAATAATTTTACAA VCA0829
Vibrio harveyi ATCC BAA-1116
Position: -130
Score: 4.87876
Sequence: GTGTAACATTTTCTTTACAT
Locus tag: VIBHAR_05420
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
acsA -130 4.9 GTGTAACATTTTCTTTACAT VIBHAR_05420
Vibrio parahaemolyticus RIMD 2210633
Position: -130
Score: 5.12347
Sequence: ATGTAACATATTGTTTACAT
Locus tag: VPA0575
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
acsA -130 5.1 ATGTAACATATTGTTTACAT VPA0575
Vibrio shilonii AK1
Position: -136
Score: 5.46411
Sequence: GTGTAACAATTTATTTACAT
Locus tag: VSAK1_21594
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
acsA -136 5.5 GTGTAACAATTTATTTACAT VSAK1_21594
Vibrio splendidus LGP32
Position: -112
Score: 5.60226
Sequence: GTGTAACATTTTATTTACAC
Locus tag: VS_II1510
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
acsA -112 5.6 GTGTAACATTTTATTTACAC VS_II1510
Vibrio vulnificus CMCP6
Position: -135
Score: 4.70291
Sequence: GTGTAACATTTTCTTTACAA
Locus tag: VV2_0456
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
acsA -135 4.7 GTGTAACATTTTCTTTACAA VV2_0456