Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing hmgB gene

Properties
Regulog: TyrR - Vibrionales
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -321
Score: 5.67525
Sequence: GTGTAACATAAATTTTACAT
Position: -164
Score: 4.30387
Sequence: ATGTAAAATATTCAACACAC
Locus tag: PBPRB1165
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: PBPRB1166
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: PBPRB1167
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
Locus tag: PBPRB1168
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
hmgA-hmgC-hmgB-acsA -321 5.7 GTGTAACATAAATTTTACAT PBPRB1165
-164 4.3 ATGTAAAATATTCAACACAC
Vibrio angustum S14
Position: -109
Score: 4.19535
Sequence: TTGTAAACAAGAATGAACAT
Locus tag: VAS14_11214
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VAS14_11209
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VAS14_11204
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
Locus tag: VAS14_11199
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
hmgA-hmgC-hmgB-acsA -109 4.2 TTGTAAACAAGAATGAACAT VAS14_11214
Vibrio cholerae O1 biovar eltor str. N16961
Position: -256
Score: 4.77228
Sequence: AAGTAACAATATTGTTACAT
Position: -86
Score: 4.72045
Sequence: ATGTAATAAAATTGTTACCT
Locus tag: VC1344
Name: hpd
Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
Locus tag: VC1345
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VC1346
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VC1347
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
hpd-hmgA-hmgC-hmgB -256 4.8 AAGTAACAATATTGTTACAT VC1344
-86 4.7 ATGTAATAAAATTGTTACCT
Vibrio harveyi ATCC BAA-1116
Position: -147
Score: 5.1829
Sequence: CTGTAACATAAATTTTACAA
Locus tag: VIBHAR_02177
Name: hpd
Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
Locus tag: VIBHAR_02178
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VIBHAR_02179
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VIBHAR_02180
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
hpd-hmgA-hmgC-hmgB -147 5.2 CTGTAACATAAATTTTACAA VIBHAR_02177
Vibrio parahaemolyticus RIMD 2210633
Position: -154
Score: 5.56288
Sequence: GTGTAACATTAATTTTACAT
Locus tag: VP1349
Name: hpd
Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
Locus tag: VP1350
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VP1351
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VP1352
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
hpd-hmgA-hmgC-hmgB -154 5.6 GTGTAACATTAATTTTACAT VP1349
Vibrio shilonii AK1
Position: -169
Score: 4.77477
Sequence: ATGTAGCAAAAATGTTACAA
Locus tag: VSAK1_19029
Name: hpd
Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
Locus tag: VSAK1_19034
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VSAK1_19039
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VSAK1_19044
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
hpd-hmgA-hmgC-hmgB -169 4.8 ATGTAGCAAAAATGTTACAA VSAK1_19029
Vibrio splendidus LGP32
Position: -146
Score: 5.39104
Sequence: GTGTAACAAATATTTTACAA
Locus tag: VS_II1521
Name: hpd
Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
Locus tag: VS_II1520
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VS_II1519
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VS_II1518
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
hpd-hmgA-hmgC-hmgB -146 5.4 GTGTAACAAATATTTTACAA VS_II1521
Vibrio vulnificus CMCP6
Position: -252
Score: 4.59528
Sequence: GGTTAACATAAAATTTACAT
Position: -137
Score: 4.67713
Sequence: GTGTAACAAATGCTTTACAT
Locus tag: VV1_2768
Name: hpd
Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
Locus tag: VV1_2767
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VV1_2766
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VV1_2765
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
hpd-hmgA-hmgC-hmgB -252 4.6 GGTTAACATAAAATTTACAT VV1_2768
-137 4.7 GTGTAACAAATGCTTTACAT