Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing phhB gene

Regulog: TyrR - Vibrionales
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -243
Score: 5.7237
Locus tag: PBPRB1164
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC
Locus tag: PBPRB1163
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC
Vibrio angustum S14
Position: -182
Score: 3.82606
Locus tag: VAS14_11219
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC
Locus tag: VAS14_11224
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC
phhA-phhB -182 3.8 ATGTTCATTCTTGTTTACAA VAS14_11219
Vibrio cholerae O1 biovar eltor str. N16961
Position: -34
Score: 5.44106
Locus tag: VCA0828
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC
Locus tag: VCA0827
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC
Vibrio harveyi ATCC BAA-1116
Position: -111
Score: 6.11164
Locus tag: VIBHAR_05421
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC
Locus tag: VIBHAR_05422
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC
Vibrio parahaemolyticus RIMD 2210633
Position: -111
Score: 5.6404
Locus tag: VPA0576
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC
Locus tag: VPA0577
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC
Vibrio shilonii AK1
Position: -109
Score: 6.2567
Locus tag: VSAK1_21599
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC
Locus tag: VSAK1_21604
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC
Vibrio splendidus LGP32
Position: -107
Score: 6.45229
Locus tag: VS_II1509
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC
Locus tag: VS_II1508
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC
Vibrio vulnificus CMCP6
Position: -111
Score: 5.92476
Locus tag: VV20455
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC
Locus tag: VV20454
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC