Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing COG0733 gene

Properties
Regulog: TyrR - Vibrionales
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -74
Score: 5.37806
Sequence: CTGTACATAATAGTTTACAG
Locus tag: PBPRA2512
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733 -74 5.4 CTGTACATAATAGTTTACAG PBPRA2512
Vibrio angustum S14
Position: -243
Score: 4.79539
Sequence: GTGTAAACCTTAAATAACAC
Locus tag: VAS14_13304
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733 -243 4.8 GTGTAAACCTTAAATAACAC VAS14_13304
Vibrio cholerae O1 biovar eltor str. N16961
Position: -50
Score: 5.72507
Sequence: GTGTAATTTTATTTTTACAC
Locus tag: VC1669
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733 -50 5.7 GTGTAATTTTATTTTTACAC VC1669
Vibrio fischeri ES114
Position: -78
Score: 5.16449
Sequence: ATGTACAAAAATATGTACAC
Locus tag: VF_1605
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733 -78 5.2 ATGTACAAAAATATGTACAC VF_1605
Vibrio harveyi ATCC BAA-1116
Position: -136
Score: 5.90136
Sequence: GTGTACATTAATATTTACAC
Locus tag: VIBHAR_02692
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733 -136 5.9 GTGTACATTAATATTTACAC VIBHAR_02692
Vibrio parahaemolyticus RIMD 2210633
Position: -80
Score: 6.01372
Sequence: GTGTATATAAATATTTACAC
Locus tag: VP1184
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733 -80 6 GTGTATATAAATATTTACAC VP1184
Vibrio salmonicida LFI1238
Position: -52
Score: 5.61488
Sequence: ATGTAAAATATAATTTACAA
Locus tag: VSAL_I1935
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733 -52 5.6 ATGTAAAATATAATTTACAA VSAL_I1935
Vibrio shilonii AK1
Position: -154
Score: 5.89263
Sequence: GTGTAAACTAAAGATTACAC
Locus tag: VSAK1_01272
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733 -154 5.9 GTGTAAACTAAAGATTACAC VSAK1_01272
Vibrio splendidus LGP32
Position: -87
Score: 5.86814
Sequence: GTGTAAATTATTATATACAC
Locus tag: VS_1980
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733 -87 5.9 GTGTAAATTATTATATACAC VS_1980
Vibrio vulnificus CMCP6
Position: -82
Score: 5.32506
Sequence: GTGTAAAAAATTTTGTACAT
Locus tag: VV1_2869
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733 -82 5.3 GTGTAAAAAATTTTGTACAT VV1_2869