Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing tyrA gene

Regulog: TyrR - Vibrionales
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/Gamma
Built upon 83 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -171
Score: 5.19403
Locus tag: PBPRA3026
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC
Locus tag: PBPRA3025
Name: tyrA
Funciton: Chorismate mutase I (EC / Cyclohexadienyl dehydrogenase (EC
Vibrio angustum S14
Position: -161
Score: 6.10089
Locus tag: VAS14_20611
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC
Locus tag: VAS14_20616
Name: tyrA
Funciton: Chorismate mutase I (EC / Cyclohexadienyl dehydrogenase (EC
aroF-tyrA -161 6.1 CTGTAAATAATTATTTACAG VAS14_20611
Vibrio cholerae O1 biovar eltor str. N16961
Position: -135
Score: 5.39538
Position: -28
Score: 6.25296
Locus tag: VC0695
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC
Locus tag: VC0696
Name: tyrA
Funciton: Chorismate mutase I (EC / Cyclohexadienyl dehydrogenase (EC
Vibrio fischeri ES114
Position: -139
Score: 5.08858
Position: -29
Score: 5.78567
Locus tag: VF_0553
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC
Locus tag: VF_0554
Name: tyrA
Funciton: Chorismate mutase I (EC / Cyclohexadienyl dehydrogenase (EC
Vibrio harveyi ATCC BAA-1116
Position: -139
Score: 6.41548
Position: -29
Score: 5.99042
Locus tag: VIBHAR_00992
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC
Locus tag: VIBHAR_00993
Name: tyrA
Funciton: Chorismate mutase I (EC / Cyclohexadienyl dehydrogenase (EC
Vibrio parahaemolyticus RIMD 2210633
Position: -139
Score: 6.52573
Position: -29
Score: 6.04794
Locus tag: VP0546
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC
Locus tag: VP0547
Name: tyrA
Funciton: Chorismate mutase I (EC / Cyclohexadienyl dehydrogenase (EC
Vibrio salmonicida LFI1238
Position: -137
Score: 5.08858
Position: -28
Score: 5.2079
Locus tag: VSAL_I0653
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC
Locus tag: VSAL_I0654
Name: tyrA
Funciton: Chorismate mutase I (EC / Cyclohexadienyl dehydrogenase (EC
Vibrio shilonii AK1
Position: -141
Score: 5.96273
Position: -28
Score: 6.37222
Locus tag: VSAK1_14082
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC
Locus tag: VSAK1_14087
Name: tyrA
Funciton: Chorismate mutase I (EC / Cyclohexadienyl dehydrogenase (EC
Vibrio splendidus LGP32
Position: -135
Score: 6.2217
Position: -28
Score: 6.04794
Locus tag: VS_0547
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC
Locus tag: VS_0548
Name: tyrA
Funciton: Chorismate mutase I (EC / Cyclohexadienyl dehydrogenase (EC
Vibrio vulnificus CMCP6
Position: -137
Score: 5.61672
Position: -30
Score: 5.93959
Locus tag: VV1_0495
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC
Locus tag: VV1_0494
Name: tyrA
Funciton: Chorismate mutase I (EC / Cyclohexadienyl dehydrogenase (EC
aroF-tyrA -137 5.6 GTGTAATTTATTTTTTACAC VV1_0495