Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing int gene

Properties
Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -33
Score: 4.63328
Sequence: AAAAAAGAACGTATGTGCGAAAGG
Locus tag: lin2426
Name: int
Funciton: Integrase
int -33 4.6 AAAAAAGAACGTATGTGCGAAAGG lin2426
Listeria monocytogenes EGD-e
Position: -33
Score: 4.63328
Sequence: AAAAAAGAACGTATGTGCGAAAGG
Locus tag: lmo2332
Name: int
Funciton: Integrase
int -33 4.6 AAAAAAGAACGTATGTGCGAAAGG lmo2332