Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing lin1681 gene

Properties
Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -47
Score: 4.64164
Sequence: AAAAGGGAACGTATGTTTTATGAT
Locus tag: lin1681
Name: lin1681
Funciton: Conserved hypothetical protein
Locus tag: lin1680
Name: tag
Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20)
Locus tag: lin1679
Name: lin1679
Funciton: Putative carboxypeptidase
lin1681-tag-lin1679 -47 4.6 AAAAGGGAACGTATGTTTTATGAT lin1681
Listeria monocytogenes EGD-e
Position: -47
Score: 4.93443
Sequence: AAAACAGAACATATGTTTTATCAT
Locus tag: lmo1640
Name: lin1681
Funciton: Conserved hypothetical protein
Locus tag: lmo1639
Name: tag
Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20)
Locus tag: lmo1638
Name: lin1679
Funciton: Putative carboxypeptidase
lin1681-tag-lin1679 -47 4.9 AAAACAGAACATATGTTTTATCAT lmo1640
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -47
Score: 4.72754
Sequence: AAAATAGAACGTATGTTTTATGAT
Locus tag: lse_1561
Name: lin1681
Funciton: Conserved hypothetical protein
Locus tag: lse_1560
Name: tag
Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20)
Locus tag: lse_1559
Name: lin1679
Funciton: Putative carboxypeptidase
lin1681-tag-lin1679 -47 4.7 AAAATAGAACGTATGTTTTATGAT lse_1561
Listeria welshimeri serovar 6b str. SLCC5334
Position: -47
Score: 5.14336
Sequence: AAAACAGAACATATGTTTTATGAT
Locus tag: lwe1656
Name: lin1681
Funciton: Conserved hypothetical protein
Locus tag: lwe1655
Name: tag
Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20)
Locus tag: lwe1654
Name: lin1679
Funciton: Putative carboxypeptidase
lin1681-tag-lin1679 -47 5.1 AAAACAGAACATATGTTTTATGAT lwe1656