Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing srmB gene

Properties
Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -57
Score: 4.67387
Sequence: TGATGCGAACGTAGGTTCTGTGTT
Locus tag: lin0195
Name: srmB
Funciton: DinG family ATP-dependent helicase CPE1197
Locus tag: lin0196
Name: yxeH
Funciton: Cof-like hydrolase
srmB-yxeH -57 4.7 TGATGCGAACGTAGGTTCTGTGTT lin0195
Listeria monocytogenes EGD-e
Position: -57
Score: 4.25077
Sequence: TGTTGCGAACGTAGGTTCTGTGTT
Locus tag: lmo0157
Name: srmB
Funciton: DinG family ATP-dependent helicase CPE1197
Locus tag: lmo0158
Name: yxeH
Funciton: Cof-like hydrolase
srmB-yxeH -57 4.3 TGTTGCGAACGTAGGTTCTGTGTT lmo0157